test_page.markdown

layout	title	permalink	exclude
page	Test Page	/test_page/	true

TEST PAGE TEST PAGE TEST PAGE TEST PAGE!!!

Detected as RS by 19 out of 20 classifiers

5HSAA047488	Similarity: 0.975	Similarity: 0.966	Similarity: 0.970
UTR: 5HSAA047488 Gene: GUCY2D MFE: -44.146 ENS: 0.917 Length: 99. Predicted Ligands: TPP - 11/20 glycine - 3/20 zmp-ztp - 2/20	RS: URS0000AB764C_910954 MFE: -36.601 Ligand: glycine Species: Dietzia cinnamea P4 Glycine riboswitch	RS: URS0000C84446_1666909 MFE: -25.306 Ligand: TPP Species: Bacteroidetes bacterium HLUCCA01 TPP riboswitch (THI element)	RS: URS0000C1EEA0_1523621 MFE: -34.772 Ligand: TPP Species: Cellulosimicrobium sp. MM TPP riboswitch (THI element)

Base pair probability heatmaps

Information

	5'UTR	RS match 1	RS match 2	RS match 3
Link	-	RNAcentral	RNAcentral	RNAcentral
ID	5HSAA047488	URS0000AB764C_910954	URS0000C84446_1666909	URS0000C1EEA0_1523621
Length	99.	97.	96.	98.
Similarity	-	0.975	0.966	0.970
Ensemble Norm	0.917	-	-	-
MFE	-44.146	-36.601	-25.306	-34.772
Ligands	-	glycine	TPP	TPP
Gene	GUCY2D	-	-	-
Downstream protein	Genecard	-	-	-

Similarity metrics

	5'UTR	RS match 1	RS match 2	RS match 3
Struct SE	-	4.	19.008	23.002
Length SE	-	4.	9.	1.
Lev Distance	-	28.	27.	29.
UBS	9.	8.	7.	8.
BS	0.	0.	0.	0.
ILL	1.	2.	1.	3.
ILR	1.	1.	3.	4.
H	3.	3.	2.	2.
BL	3.	2.	0.	1.
BR	3.	2.	2.	1.
UN	0.192	0.206	0.104	0.143

Sequences

Field	Description
UTR seq + 25	caaaagggggaccggcccugugaccccucaccgggggccgugggcccgagcccccggacuucccuaagccggcaATGACCGCCTGCGCCCGCCGAGCGG
UTR dot + 25	.....(((((..((((((((.(.(((((....)))))))).)))).))..)))))............((.(((.......))).))..((((...))))
RS 1 seq	ACGCGUCCCACGGGAGAGCUCCGCGGCCAUGGCCGCGGGCGCCGAAGGAGCAACUCCUCUCCGAGAAUCUCUCAGGCACCCGGACCGUGCGGUCGUC
RS 1 dot	..((.(((..(((....((.(((((((....))))))))).)))..))))).........((((((...)))).))......((((....))))...
RS 2 seq	AAACAAGGUUGGGGGUGCUGGCAAAACUGGCUGAGAACAUACCCCAUAUUACCUGAUCCGGAUAAUGCCGGCGAAGGGAAACCGGUACAGACCCGU
RS 2 dot	.....(((((((((((((((((.......))).))..))).)))))....))))....(((....((((((..........)))))).....))).
RS 3 seq	GUGACCGACACGGGGUGCCCCGCGCACGCGGGGCUGAGAUCACACCCGUCGAACCUGCUCUGGCUCGUACCAGCGAAGGGAUGUCCGCCGAUGCCGCU
RS 3 dot	.....((((..((((((((((((....))))))).......)).))))))).....((..((((.((..((......))..))...))))..))....

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table

Abstract

Riboswitches are a class of noncoding RNA structures that interact with target ligands to cause a conformational change that can then execute some regulatory purpose within the cell. Riboswitches are ubiquitous and well characterized in bacteria, with additional examples also being found in fungi, plants, and yeast. To date, no purely RNA-small molecule riboswitch has been discovered in Homo Sapiens. Several analogous riboswitch-like mechanisms have been described within the H. Sapiens translatome within the past decade, prompting the question: Is there a H. Sapiens riboswitch dependent on only small molecule ligands? In this work, we trained positive-unlabeled machine learning classifiers on known riboswitch sequences and apply the classifiers to H. Sapiens mRNA 5’ 5'UTR sequences found in the 5'UTR database, UTRdb, in the hope of identifying a set of mRNAs to investigate for riboswitch functionality. 67,683 riboswitch sequences were obtained from RNAcentral and sorted for ligand type and used as positive examples and 48,031 5'UTR sequences were used as unlabeled, unknown examples. Positive examples were sorted by ligand, and 20 positive-unlabeled classifiers were trained on sequence and secondary structure features while withholding one or two ligand classes. Cross validation was then performed on the withheld ligand sets to obtain a validation accuracy range of 75%-99%. The joint sets of 5'UTRs identified as potential riboswitches by the 20 classifiers were then analyzed. 1515 sequences were identified as a riboswitch by one or more classifier(s) and 436 of the H. Sapiens 5'UTRs were labeled as harboring potential riboswitch elements by all 20 classifiers. These 436 sequences were mapped back to the most similar riboswitches within the positive data and examined. An online database of identified and ranked 5'UTRs, their features, and their most similar matches to known riboswitches, is provided to guide future experimental efforts to identify H. Sapiens riboswitches

How to use the website

Contact info

William S. Raymond^1,&, Jacob DeRoo¹, Brian Munsky^1,2,$

^{1 School of Biomedical Engineering, Colorado State University Fort Collins, CO 80523, USA 2 Chemical and Biological Engineering, Colorado State University Fort Collins, CO 80523, USA}

& [email protected]

$ [email protected]

Table links

Link to Ensemble of 20 table

Link to Ensemble of 1 table