PD-2803: Fixing Optimus h5ad generation to handle gene_ids more flexi…

…bly (#1431) Updated docker for h5ad creation in Optimus allowing for more flexible gene_id handling
broadinstitute · Dec 3, 2024 · 39c6aac · 39c6aac
1 parent 158772d
commit 39c6aac
Show file tree

Hide file tree

Showing 10 changed files with 21 additions and 12 deletions.
diff --git a/pipeline_versions.txt b/pipeline_versions.txt
@@ -30,11 +30,11 @@ ExomeReprocessing	 3.3.3	2024-11-04
 BuildIndices	 3.0.0	2023-12-06 
 scATAC	 1.3.2	2023-08-03 
 snm3C	 4.0.4	2024-08-06 
-Multiome	 5.9.2	2024-11-15 
-PairedTag	 1.8.3	2024-11-15 
+Multiome	 5.9.2	2024-11-22 
+PairedTag	 1.8.3	2024-11-22 
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
 MultiSampleSmartSeq2SingleNucleus	 2.0.5	2024-11-15 
-Optimus	 7.8.3	2024-11-15 
-atac	 2.5.2	2024-11-12 
+Optimus	 7.8.3	2024-11-22 
+atac	 2.5.3	2024-11-22 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
 SlideSeq	 3.4.6	2024-11-15 
diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
@@ -1,3 +1,8 @@
+# 2.5.3
+2024-11-22 (Date of Last Commit)
+
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files; does not impact ATAC workflow
+
 # 2.5.2
 2024-11-12 (Date of Last Commit)
 

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
@@ -49,15 +49,15 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.5.2"
+  String pipeline_version = "2.5.3"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
   String acr_docker_prefix = "dsppipelinedev.azurecr.io/"
   String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix
 
   # Docker image names
-  String warp_tools_2_2_0 = "warp-tools:2.2.0"
+  String warp_tools_2_2_0 = "warp-tools:2.5.0"
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"

diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,7 +1,8 @@
 # 5.9.2
-2024-11-15 (Date of Last Commit)
+2024-11-22 (Date of Last Commit)
 
 * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
 
 # 5.9.1
 2024-11-12 (Date of Last Commit)

diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md
@@ -1,7 +1,8 @@
 # 7.8.3
-2024-11-15 (Date of Last Commit)
+2024-11-22 (Date of Last Commit)
 
 * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
 
 # 7.8.2
 2024-11-12 (Date of Last Commit)

diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl
@@ -91,7 +91,7 @@ workflow Optimus {
   String pytools_docker = "pytools:1.0.0-1661263730"
   String empty_drops_docker = "empty-drops:1.0.1-4.2"
   String star_docker = "star:1.0.1-2.7.11a-1692706072"
-  String warp_tools_docker_2_2_0 = "warp-tools:2.4.0"
+  String warp_tools_docker_2_2_0 = "warp-tools:2.5.0"
   String star_merge_docker = "star-merge-npz:1.3.0"
   String samtools_star = "samtools-star:1.0.0-1.11-2.7.11a-1731516196"
 

diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,7 +1,8 @@
 # 1.8.3
-2024-11-15 (Date of Last Commit)
+2024-11-22 (Date of Last Commit)
 
 * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
 
 # 1.8.2
 2024-11-12 (Date of Last Commit)

diff --git a/pipelines/skylab/slideseq/SlideSeq.changelog.md b/pipelines/skylab/slideseq/SlideSeq.changelog.md
@@ -2,6 +2,7 @@
 2024-11-15 (Date of Last Commit)
 
 * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline
+* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files
 
 # 3.4.5
 2024-11-12 (Date of Last Commit)

diff --git a/pipelines/skylab/slideseq/SlideSeq.wdl b/pipelines/skylab/slideseq/SlideSeq.wdl
@@ -48,7 +48,7 @@ workflow SlideSeq {
     # docker images
     String pytools_docker = "pytools:1.0.0-1661263730"
     String picard_cloud_docker = "picard-cloud:2.26.10"
-    String warp_tools_docker_2_2_0 = "warp-tools:2.4.0"
+    String warp_tools_docker_2_2_0 = "warp-tools:2.5.0"
     String star_merge_docker = "star-merge-npz:1.3.0"
 
     String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf"

diff --git a/tasks/skylab/FastqProcessing.wdl b/tasks/skylab/FastqProcessing.wdl
@@ -138,7 +138,7 @@ task FastqProcessingSlidSeq {
 
 
     # Runtime attributes
-    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0"
+    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.5.0"
     Int cpu = 16
     Int machine_mb = 40000
     Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50