updated doc versions

broadinstitute · Jul 18, 2024 · 42e461c · 42e461c
1 parent c56468c
commit 42e461c
Show file tree

Hide file tree

Showing 5 changed files with 24 additions and 18 deletions.
diff --git a/website/docs/Pipelines/Multiome_Pipeline/README.md b/website/docs/Pipelines/Multiome_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Multiome_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [Multiome v5.0.0](https://github.com/broadinstitute/warp/releases) | May, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
+| [Multiome v5.1.0](https://github.com/broadinstitute/warp/releases) | July, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 ![Multiome_diagram](./multiome_diagram.png)
 
@@ -68,18 +68,18 @@ Multiome can be deployed using [Cromwell](https://cromwell.readthedocs.io/en/sta
 | emptydrops_lower | Optional threshold for UMIs for the Optimus (GEX) pipeline that empty drops tool should consider for determining cell; data below threshold is not removed; default is "100". | Integer |
 | force_no_check | Optional boolean for the Optimus (GEX) pipeline indicating if the pipeline should perform checks; default is "false". | Boolean |
 | ignore_r1_read_length | Optional boolean for the Optimus (GEX) pipeline indicating if the pipeline should ignore barcode chemistry check; if "true", the workflow will not ensure the `10x_chemistry_version` input matches the chemistry in the read 1 FASTQ; default is "false". | Boolean |
-| star_strand_mode | Optional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward".                                                                                          | String |
-| count_exons | Optional boolean for the Optimus (GEX) pipeline indicating if the workflow should calculate exon counts **when in single-nucleus (sn_rna) mode**; if "true" in sc_rna mode, the workflow will return an error; default is "false".                         | Boolean |
-| soloMultiMappers | Optional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the `--soloMultiMappers` flag.                                                                                                                               | String |
-| atac_r1_fastq | Array of read 1 paired-end FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                    | Array[File] |
-| atac_r2_fastq | Array of barcodes FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                             | Array[File] |
-| atac_r3_fastq | Array of read 2 paired-end FASTQ files representing a single 10x multiome ATAC library.                                                                                                                                                                    | Array[File] |
-| tar_bwa_reference | TAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.                                                                                                                                                                 | File | 
-| chrom_sizes | File containing the genome chromosome sizes; used to calculate ATAC fragment file metrics.                                                                                                                                                                 | File |
-| adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG".                                                                        | String |
-| adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG".                                                                         | String |
-| run_cellbender | Optional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, `h5ad_output_file_gex`; default is "false".                                                                                | Boolean |
-| vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s").                                                                                                                                                                   | String |
+| star_strand_mode | Optional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward". | String |
+| count_exons | Optional boolean for the Optimus (GEX) pipeline indicating if the workflow should calculate exon counts **when in single-nucleus (sn_rna) mode**; if "true" in sc_rna mode, the workflow will return an error; default is "false".  | Boolean |
+| soloMultiMappers | Optional string describing whether or not the Optimus (GEX) pipeline should run STARsolo with the `--soloMultiMappers` flag. | String |
+| atac_r1_fastq | Array of read 1 paired-end FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| atac_r2_fastq | Array of barcodes FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| atac_r3_fastq | Array of read 2 paired-end FASTQ files representing a single 10x multiome ATAC library. | Array[File] |
+| tar_bwa_reference | TAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline.  | File | 
+| chrom_sizes | File containing the genome chromosome sizes; used to calculate ATAC fragment file metrics. | File |
+| adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG". | String |
+| adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG". | String |
+| run_cellbender | Optional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, `h5ad_output_file_gex`; default is "false".  | Boolean |
+| vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s"). | String |
 
 
 #### Sample inputs for analyses in a Terra Workspace

diff --git a/website/docs/Pipelines/Optimus_Pipeline/Library-metrics.md b/website/docs/Pipelines/Optimus_Pipeline/Library-metrics.md
@@ -4,7 +4,7 @@ sidebar_position: 5
 
 # Optimus Library-level metrics
 
-The following table describes the library level metrics of the produced by the Optimus workflow. These are calcuated using custom python scripts available in the warp-tools repository. The Optimus workflow aligns files in shards to parallelize computationally intensive steps. This results in multiple matrix market files and shard-levl library metrics. 
+The following table describes the library level metrics of the produced by the Optimus workflow. These are calcuated using custom python scripts available in the warp-tools repository. The Optimus workflow aligns files in shards to parallelize computationally intensive steps. This results in multiple matrix market files and shard-level library metrics. 
 
 To produce the library-level metrics here, the [combined_mtx.py script](https://github.com/broadinstitute/warp-tools/blob/develop/3rd-party-tools/star-merge-npz/scripts/combined_mtx.py) combines all the shard-level matrix market files into one raw mtx file. Then, STARsolo is run to filter this matrix to only those barcodes that meet STARsolo's criteria of cells (using the Emptydrops_CR parameter). Lastly, the [combine_shard_metrics.py script](https://github.com/broadinstitute/warp-tools/blob/develop/3rd-party-tools/star-merge-npz/scripts/combine_shard_metrics.py) uses the filtered matrix and the all of the shard-level metrics files produced by STARsolo to calculate the metrics below. Each of the scripts are called from [MergeStarOutput task](https://github.com/broadinstitute/warp/blob/develop/tasks/skylab/StarAlign.wdl) of the Optimus workflow. 
 

diff --git a/website/docs/Pipelines/Optimus_Pipeline/README.md b/website/docs/Pipelines/Optimus_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/Optimus_Pipeline/README
 
 | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [optimus_v7.1.0](https://github.com/broadinstitute/warp/releases?q=optimus&expanded=true) | May, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues) |
+| [optimus_v7.2.0](https://github.com/broadinstitute/warp/releases?q=optimus&expanded=true) | July, 2024 | Elizabeth Kiernan | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues) |
 
 
 ![Optimus_diagram](Optimus_diagram.png)
@@ -370,4 +370,9 @@ Unlike Cell Ranger references, Optimus references are downloaded directly from G
 In the case of multi-mapped pseudogenes, Optimus and Cell Ranger will produce different results. Optimus does not count multi-mapped reads in the final count matrix, whereas Cell Ranger will keep potential multi-mapped reads because it does not identify the pseudogene reads.
 :::
 
+:::note Question How does estimated cells differ between Cell Ranger and Optimus?
+
+Overall, the estimated cells produced by Optimus and Cell Ranger should only slightly vary. However, if you are using Optimus in the Multiome pipeline and trying to compare estimated cells to Cell Ranger ARC, you might find that ARC calls fewer cells. This is because ARC sets a threshold that both the ATAC and gene expression cells must pass, whereas Optimus is only setting a threshold for the gene expression side of the pipeline.
+:::
+
 
diff --git a/website/docs/Pipelines/PairedTag_Pipeline/README.md b/website/docs/Pipelines/PairedTag_Pipeline/README.md
@@ -7,7 +7,7 @@ slug: /Pipelines/PairedTag_Pipeline/README
 
 |                          Pipeline Version                           | Date Updated | Documentation Author | Questions or Feedback |
 |:---:| :---: | :---: | :---: |
-| [PairedTag_v1.0.1](https://github.com/broadinstitute/warp/releases) | June, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
+| [PairedTag_v1.1.0](https://github.com/broadinstitute/warp/releases) | July, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 
 ## Introduction to the Paired-Tag workflow
@@ -60,6 +60,7 @@ The Paired-Tag workflow inputs are specified in JSON configuration files. Exampl
 | Parameter name | Description | Type |
 | --- | --- | --- |
 | input_id | Unique identifier describing the biological sample or replicate that corresponds with the FASTQ files; can be a human-readable name or UUID. | String |
+| nash_id | Optional identifier that can be used to demarcate the library aliquot or sample. |
 | counting_mode | Optional string that determines whether the Optimus (GEX) pipeline should be run in single-cell mode (sc_rna) or single-nucleus mode (sn_rna); default is "sn_rna". | String |
 | gex_r1_fastq | Array of read 1 FASTQ files representing a single GEX 10x library. | Array[File] |
 | gex_r2_fastq | Array of read 2 FASTQ files representing a single GEX 10x library.| Array[File] |
@@ -115,7 +116,7 @@ The Paired-Tag workflow calls two WARP subworkflows and an additional task which
 | gene_metrics_gex | `<input_id>_gex.gene_metrics.csv.gz` | CSV file containing the per-gene metrics. |
 | cell_calls_gex | `<input_id>_gex.emptyDrops` | TSV file containing the EmptyDrops results when the Optimus workflow is run in sc_rna mode. |
 | h5ad_output_file_gex | `<input_id>_gex.h5ad` | h5ad (Anndata) file containing the raw cell-by-gene count matrix, gene metrics, cell metrics, and global attributes. See the [Optimus Count Matrix Overview](../Optimus_Pipeline/Loom_schema.md) for more details. |
-| library_metrics | `<input_id>_library_metrics.csv` | Optional CSV file containing all library-level metrics calculated with STARsolo for gene expression data. |
+| library_metrics | `<input_id>_<nhash_id>_library_metrics.csv` | Optional CSV file containing all library-level metrics calculated with STARsolo for gene expression data. |
 | cloud_provider  | String describing the cloud provider that should be used to run the workflow; value should be "gcp" or "azure". | String      |
 | multimappers_EM_matrix | `UniqueAndMult-EM.mtx` | Optional output produced when `soloMultiMappers` is "EM"; see STARsolo [documentation](https://github.com/alexdobin/STAR/blob/master/docs/STARsolo.md#multi-gene-reads) for more information.|
 | multimappers_Uniform_matrix | `UniqueAndMult-Uniform.mtx` | Optional output produced when `soloMultiMappers` is "Uniform" (default); see STARsolo [documentation](https://github.com/alexdobin/STAR/blob/master/docs/STARsolo.md#multi-gene-reads) for more information.|

diff --git a/website/docs/Pipelines/snM3C/README.md b/website/docs/Pipelines/snM3C/README.md
@@ -6,7 +6,7 @@ slug: /Pipelines/snm3C/README
 
 | Pipeline Version | Date Updated | Documentation Authors | Questions or Feedback |
 | :----: | :---: | :----: | :--------------: |
-| [snm3C_v4.0.0](https://github.com/broadinstitute/warp/releases) | March, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
+| [snm3C_v4.0.1](https://github.com/broadinstitute/warp/releases) | March, 2024 | Kaylee Mathews | Please [file an issue in WARP](https://github.com/broadinstitute/warp/issues). |
 
 
 ## Introduction to snm3C