-
Notifications
You must be signed in to change notification settings - Fork 100
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Km Update Paired-Tag Overview doc (#1280)
* Update README.md * Update README.md
- Loading branch information
1 parent
9cd7ca1
commit fb2c2bc
Showing
1 changed file
with
5 additions
and
5 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
|
|
@@ -5,9 +5,9 @@ slug: /Pipelines/PairedTag_Pipeline/README | |
|
|
||
| # Paired-Tag Overview | ||
|
|
||
| | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback | | ||
| |:-------------------------------------------------------------------:| :---: | :----: | :--------------: | | ||
| | [PairedTag_v0.5.2](https://github.com/broadinstitute/warp/releases) | February, 2024 | Kaylee Mathews | Please file GitHub issues in warp or contact [documentation authors](mailto:[email protected]) | | ||
| | Pipeline Version | Date Updated | Documentation Author | Questions or Feedback | | ||
| | :--------------: | :----------: | :------------------: | :-------------------: | | ||
| | [PairedTag_v0.6.1](https://github.com/broadinstitute/warp/releases) | May, 2024 | Kaylee Mathews | Please file GitHub issues in warp or contact [documentation authors](mailto:[email protected]) | | ||
|
|
||
|
|
||
| ## Introduction to the Paired-Tag workflow | ||
|
|
@@ -76,15 +76,15 @@ The Paired-Tag workflow inputs are specified in JSON configuration files. Exampl | |
| | ignore_r1_read_length | Optional boolean for the Optimus (GEX) pipeline indicating if the pipeline should ignore barcode chemistry check; if "true", the workflow will not ensure the `10x_chemistry_version` input matches the chemistry in the read 1 FASTQ; default is "false". | Boolean | | ||
| | star_strand_mode | Optional string for the Optimus (GEX) pipeline for performing STARsolo alignment on forward stranded, reverse stranded, or unstranded data; default is "Forward". | String | | ||
| | count_exons | Optional boolean for the Optimus (GEX) pipeline indicating if the workflow should calculate exon counts **when in single-nucleus (sn_rna) mode**; if "true" in sc_rna mode, the workflow will return an error; default is "false". | Boolean | | ||
| | gex_whitelist | Optional file containing the list of valid barcodes for 10x multiome GEX data; default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt". | File | | ||
| | gex_whitelist | Optional file containing the list of valid barcodes for 10x multiome GEX data; when `cloud_provider = "gcp"`, default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt", otherwise default is "https://datasetpublicbroadref.blob.core.windows.net/dataset/RNA/resources/arc-v1/737K-arc-v1_gex.txt?sv=2020-04-08&si=prod&sr=c&sig=DQxmjB4D1lAfOW9AxIWbXwZx6ksbwjlNkixw597JnvQ%3D". | File | | ||
| | atac_r1_fastq | Array of read 1 paired-end FASTQ files representing a single paired-tag DNA library. | Array[File] | | ||
| | atac_r2_fastq | Array of barcodes FASTQ files representing a single paired-tag DNA library. | Array[File] | | ||
| | atac_r3_fastq | Array of read 2 paired-end FASTQ files representing a single paired-tag DNA library. | Array[File] | | ||
| | tar_bwa_reference | TAR file containing the reference index files for BWA-mem alignment for the ATAC pipeline. | File | | ||
| | chrom_sizes | File containing the genome chromosome sizes; used to calculate ATAC fragment file metrics. | File | | ||
| | adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG". | String | | ||
| | adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG". | String | | ||
| | atac_whitelist | Optional file containing the list of valid barcodes for 10x multiome ATAC adata; default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_atac.txt". | File | | ||
| | atac_whitelist | Optional file containing the list of valid barcodes for 10x multiome ATAC adata; when `cloud_provider = "gcp"`, default is "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_atac.txt", otherwise default is "https://datasetpublicbroadref.blob.core.windows.net/dataset/RNA/resources/arc-v1/737K-arc-v1_atac.txt?sv=2020-04-08&si=prod&sr=c&sig=DQxmjB4D1lAfOW9AxIWbXwZx6ksbwjlNkixw597JnvQ%3D". | File | | ||
| | preindex | Optional boolean for the ATAC workflow; if “true”, the pipeline will run the ATAC workflow with a preindexing task necessary for processing of droplet-based Paired-Tag data where sample barcodes from read2 are combined with cell barcodes into the BB tag of the output BAM file; if “false”, the pipeline will run the ATAC workflow without preindexing and cell barcodes are stored in the CB tag of the output BAM file; default is “true”. | Boolean | | ||
|
|
||
|
|
||
|
|
||