Np loom to h5ad snss2

pipeline_versions.txt

@@ -1,15 +1,15 @@
 Pipeline Name	Version	Date of Last Commit
-MultiSampleSmartSeq2SingleNucleus	 1.4.2	2024-08-25-02 
-MultiSampleSmartSeq2	 2.2.21	2023-04-19 
-PairedTag	 1.6.0	2024-08-02 
-Optimus	 7.6.0	2024-08-06 
-atac	 2.3.0	2024-08-29 
+MultiSampleSmartSeq2SingleNucleus	 2.0.0	2024-09-11 
+MultiSampleSmartSeq2	 2.2.22	2024-09-11 
+PairedTag	 1.6.1	2024-09-11 
+Optimus	 7.6.1	2024-09-11 
+atac	 2.3.1	2024-09-11 
 snm3C	 4.0.4	2024-08-06 
-SmartSeq2SingleSample	 5.1.20	2023-04-19 
-Multiome	 5.6.0	2024-08-02 
+SmartSeq2SingleSample	 5.1.21	2024-09-11 
+Multiome	 5.6.1	2024-09-11 
 scATAC	 1.3.2	2023-08-03 
 BuildIndices	 3.0.0	2023-12-06 
-SlideSeq	 3.4.0	2024-08-06 
+SlideSeq	 3.4.1	2024-09-11 
 BuildCembaReferences	 1.0.0	2020-11-15 
 CEMBA	 1.1.7	2024-09-06 
 GDCWholeGenomeSomaticSingleSample	 1.3.3	2024-09-06 

pipelines/skylab/atac/atac.changelog.md

@@ -1,3 +1,8 @@
+# 2.3.1
+2024-09-11 (Date of Last Commit)
+
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the atac pipeline
+
 # 2.3.0
 2024-08-29 (Date of Last Commit)
 

pipelines/skylab/atac/atac.wdl

@@ -46,7 +46,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.3.0"
+  String pipeline_version = "2.3.1"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"

pipelines/skylab/multiome/Multiome.changelog.md

@@ -1,3 +1,7 @@
+# 5.6.1
+2024-09-11 (Date of Last Commit)
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the Multiome pipeline
+
 # 5.6.0
 2024-08-02 (Date of Last Commit)
 

pipelines/skylab/multiome/Multiome.wdl

@@ -9,7 +9,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.6.0"
+    String pipeline_version = "5.6.1"
 
 
     input {

pipelines/skylab/optimus/Optimus.changelog.md

@@ -1,3 +1,7 @@
+# 7.6.1
+2024-09-11 (Date of Last Commit)
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the Optimus pipeline
+
 # 7.6.0
 2024-08-06 (Date of Last Commit)
 

pipelines/skylab/optimus/Optimus.wdl

@@ -71,7 +71,7 @@ workflow Optimus {
   # version of this pipeline
 
 
-  String pipeline_version = "7.6.0"
+  String pipeline_version = "7.6.1"
 
 
   # this is used to scatter matched [r1_fastq, r2_fastq, i1_fastq] arrays
@@ -91,7 +91,7 @@ workflow Optimus {
   String pytools_docker = "pytools:1.0.0-1661263730"
   String empty_drops_docker = "empty-drops:1.0.1-4.2"
   String star_docker = "star:1.0.1-2.7.11a-1692706072"
-  String warp_tools_docker_2_2_0 = "warp-tools:2.2.0"
+  String warp_tools_docker_2_2_0 = "warp-tools:2.3.0"
   String star_merge_docker = "star-merge-npz:1.2"
 
   #TODO how do we handle these?

pipelines/skylab/paired_tag/PairedTag.changelog.md

@@ -1,3 +1,7 @@
+# 1.6.1
+2024-09-11 (Date of Last Commit)
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the PairedTag pipeline
+
 # 1.6.0
 2024-08-02 (Date of Last Commit)
 

pipelines/skylab/paired_tag/PairedTag.wdl

@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.6.0"
+    String pipeline_version = "1.6.1"
 
 
     input {

pipelines/skylab/slideseq/SlideSeq.changelog.md

@@ -1,3 +1,8 @@
+# 3.4.1
+2024-09-11 (Date of Last Commit)
+
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the SlideSeq pipeline
+
 # 3.4.0
 2024-08-06 (Date of Last Commit)
 

pipelines/skylab/slideseq/SlideSeq.wdl

@@ -25,7 +25,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow SlideSeq {
 
-    String pipeline_version = "3.4.0"
+    String pipeline_version = "3.4.1"
 
     input {
         Array[File] r1_fastq
@@ -48,7 +48,7 @@ workflow SlideSeq {
     # docker images
     String pytools_docker = "pytools:1.0.0-1661263730"
     String picard_cloud_docker = "picard-cloud:2.26.10"
-    String warp_tools_docker_2_2_0 = "warp-tools:2.2.0"
+    String warp_tools_docker_2_2_0 = "warp-tools:2.3.0"
     String star_merge_docker = "star-merge-npz:1.2"
 
     String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf"

pipelines/skylab/smartseq2_multisample/MultiSampleSmartSeq2.changelog.md

@@ -1,3 +1,8 @@
+# 2.2.22
+2024-09-11 (Date of Last Commit)
+
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the MultiSmartSeq2 pipeline
+
 # 2.2.21
 2023-04-19 (Date of Last Commit)
 

pipelines/skylab/smartseq2_multisample/MultiSampleSmartSeq2.wdl

@@ -40,7 +40,7 @@ workflow MultiSampleSmartSeq2 {
       Boolean paired_end
   }
   # Version of this pipeline
-  String pipeline_version = "2.2.21"
+  String pipeline_version = "2.2.22"
 
   if (false) {
      String? none = "None"

pipelines/skylab/smartseq2_single_nucleus_multisample/MultiSampleSmartSeq2SingleNucleus.changelog.md

@@ -1,3 +1,8 @@
+# 2.0.0
+2024-09-11 (Dat of Last Commit)
+
+* Added h5ad as a format option for the cell by gene matrix output. The h5ad has the same layers and global attributes (unstructured data in h5ad) as the previous Loom output
+
 # 1.4.2
 2024-08-25-02 (Dat of Last Commit)
 

pipelines/skylab/smartseq2_single_nucleus_multisample/MultiSampleSmartSeq2SingleNucleus.wdl

@@ -5,7 +5,7 @@ import "../../../tasks/skylab/TrimAdapters.wdl" as TrimAdapters
 import "../../../tasks/skylab/StarAlign.wdl" as StarAlign
 import "../../../tasks/skylab/Picard.wdl" as Picard
 import "../../../tasks/skylab/FeatureCounts.wdl" as CountAlignments
-import "../../../tasks/skylab/LoomUtils.wdl" as LoomUtils
+import "../../../tasks/skylab/H5adUtils.wdl" as H5adUtils
 import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow MultiSampleSmartSeq2SingleNucleus {
@@ -57,7 +57,7 @@ workflow MultiSampleSmartSeq2SingleNucleus {
   }
 
   # Version of this pipeline
-  String pipeline_version = "1.4.2"
+  String pipeline_version = "2.0.0"
 
   if (false) {
      String? none = "None"
@@ -129,7 +129,7 @@ workflow MultiSampleSmartSeq2SingleNucleus {
             annotation_gtf = annotations_gtf
     }
 
-    call LoomUtils.SingleNucleusSmartSeq2LoomOutput as LoomOutput {
+    call H5adUtils.SingleNucleusSmartSeq2H5adOutput as H5adOutput {
         input:
             input_ids = input_ids,
             input_names = input_names,
@@ -144,28 +144,22 @@ workflow MultiSampleSmartSeq2SingleNucleus {
             annotation_introns_added_gtf = annotations_gtf
     }
 
-  ### Aggregate the Loom Files Directly ###
-  call LoomUtils.AggregateSmartSeq2Loom as AggregateLoom {
+  ### Aggregate the H5ad Files Directly ###
+  call H5adUtils.AggregateSmartSeq2H5ad as AggregateH5ad {
     input:
-      loom_input = LoomOutput.loom_output,
-      batch_id = batch_id,
-      batch_name = batch_name,
-      project_id = if defined(project_id) then select_first([project_id])[0] else none,
-      project_name = if defined(project_name) then select_first([project_name])[0] else none,
-      library = if defined(library) then select_first([library])[0] else none,
-      species = if defined(species) then select_first([species])[0] else none,
-      organ = if defined(organ) then select_first([organ])[0] else none,
-      pipeline_version = "MultiSampleSmartSeq2SingleNucleus_v~{pipeline_version}"
+      h5ad_input = H5adOutput.h5ad_output,
+      pipeline_version = pipeline_version,
+      batch_id = batch_id
   }
 
 
 
   ### Pipeline output ###
   output {
-    # loom output, exon/intron count tsv files and the aligned bam files
-    File loom_output = AggregateLoom.loom_output_file
+    # h5ad output, exon/intron count tsv files and the aligned bam files
+    File h5ad_output = AggregateH5ad.h5ad_output_file
     File genomic_reference_version = ReferenceCheck.genomic_ref_version
-    Array[File] exon_intron_count_files = LoomOutput.exon_intron_counts
+    Array[File] exon_intron_count_files = H5adOutput.exon_intron_counts
     Array[File] bam_files = RemoveDuplicatesFromBam.output_bam
     String pipeline_version_out = pipeline_version
   }

pipelines/skylab/smartseq2_single_sample/SmartSeq2SingleSample.changelog.md

@@ -1,3 +1,8 @@
+# 5.1.21
+2024-09-11 (Date of Last Commit)
+
+* Updated warp-tools docker which added create_h5ad_snss2.py to the docker image. This change does not affect the SmartSeq2SingleSample pipeline
+
 # 5.1.20
 2023-04-19 (Date of Last Commit)
 

pipelines/skylab/smartseq2_single_sample/SmartSeq2SingleSample.wdl

@@ -36,7 +36,7 @@ workflow SmartSeq2SingleSample {
   }
 
   # version of this pipeline
-  String pipeline_version = "5.1.20"
+  String pipeline_version = "5.1.21"
 
   parameter_meta {
     genome_ref_fasta: "Genome reference in fasta format"

tasks/skylab/FastqProcessing.wdl

@@ -138,7 +138,7 @@ task FastqProcessingSlidSeq {
 
 
     # Runtime attributes
-    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.0.0"
+    String docker =  "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0"
     Int cpu = 16
     Int machine_mb = 40000
     Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50

tasks/skylab/H5adUtils.wdl

@@ -552,4 +552,138 @@ task SingleNucleusSlideseqH5adOutput {
     output {
         File h5ad_output = "~{input_id}.h5ad"
     }
+}
+
+task SingleNucleusSmartSeq2H5adOutput {
+    input {
+        #runtime values
+        String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0"
+
+        Array[File] alignment_summary_metrics
+        Array[File] dedup_metrics
+        Array[File] gc_bias_summary_metrics
+
+        # introns counts
+        Array[File] introns_counts
+        # exons counts
+        Array[File] exons_counts
+        # annotation file
+        File annotation_introns_added_gtf
+        # name of the sample
+        Array[String] input_ids
+        Array[String]? input_names
+        String? input_id_metadata_field
+        String? input_name_metadata_field
+
+        String pipeline_version
+        Int preemptible = 3
+        Int disk = 200
+        Int machine_mem_mb = 8000
+        Int cpu = 4
+    }
+
+    meta {
+        description: "This task will convert output from the SmartSeq2SingleNucleus pipeline into a loom file. Contrary to the SmartSeq2 single cell where there is only RSEM counts, here we have intronic and exonic counts per gene name"
+    }
+
+    parameter_meta {
+        preemptible: "(optional) if non-zero, request a pre-emptible instance and allow for this number of preemptions before running the task on a non preemptible machine"
+    }
+
+    command <<<
+        set -euo pipefail
+
+        declare -a introns_counts_files=(~{sep=' ' introns_counts})
+        declare -a exons_counts_files=(~{sep=' ' exons_counts})
+        declare -a output_prefix=(~{sep=' ' input_ids})
+        declare -a alignment_summary_metrics_list=(~{sep=' 'alignment_summary_metrics})
+        declare -a dedup_metrics_list=(~{sep=' 'dedup_metrics})
+        declare -a gc_bias_summary_metrics_list=(~{sep=' 'gc_bias_summary_metrics})
+
+        for (( i=0; i<${#introns_counts_files[@]}; ++i));
+        do
+        # creates a table with gene_id, gene_name, intron and exon counts
+        echo "Running create_snss2_counts_csv."
+        python /warptools/scripts/create_snss2_counts_csv.py \
+        --in-gtf ~{annotation_introns_added_gtf} \
+        --intron-counts ${introns_counts_files[$i]} \
+        --exon-counts ${exons_counts_files[$i]}  \
+        -o "${output_prefix[$i]}.exon_intron_counts.tsv"
+        echo "Success create_snss2_counts_csv."
+
+        # groups the QC file into one file
+        echo "Running GroupQCs"
+        GroupQCs -f "${alignment_summary_metrics_list[$i]}" "${dedup_metrics_list[$i]}" "${gc_bias_summary_metrics_list[$i]}" \
+        -t Picard -o "${output_prefix[$i]}.Picard_group"
+        echo "Success GroupQCs"
+
+        # create the loom file
+        echo "Running create_h5ad_snss2."
+        python3 /warptools/scripts/create_h5ad_snss2.py \
+        --qc_files "${output_prefix[$i]}.Picard_group.csv" \
+        --count_results  "${output_prefix[$i]}.exon_intron_counts.tsv" \
+        --output_h5ad_path "${output_prefix[$i]}" \
+        --input_id ${output_prefix[$i]} \
+        ~{"--input_id_metadata_field " + input_id_metadata_field} \
+        ~{"--input_name_metadata_field " + input_name_metadata_field} \
+        --pipeline_version ~{pipeline_version}
+
+        echo "Success create_h5ad_snss2"
+        done;
+    >>>
+
+    runtime {
+        docker: docker
+        cpu: cpu
+        memory: "~{machine_mem_mb} MiB"
+        disks: "local-disk ~{disk} HDD"
+        disk: disk + " GB" # TES
+        preemptible: preemptible
+    }
+
+    output {
+        Array[File] h5ad_output = glob("*.h5ad")
+        Array[File] exon_intron_counts = glob("*exon_intron_counts.tsv")
+    }
+}
+
+task AggregateSmartSeq2H5ad {
+    input {
+        Array[File] h5ad_input
+        String batch_id
+        String pipeline_version
+        String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0"
+        Int disk = 200
+        Int machine_mem_mb = 4000
+        Int cpu = 1
+    }
+
+    meta {
+        description: "aggregate the H5AD output"
+    }
+
+    command {
+        set -e
+
+        # Merge the h5ad files
+        python3 /warptools/scripts/ss2_h5ad_merge.py \
+        --input-h5ad-files ~{sep=' ' h5ad_input} \
+        --output-h5ad-file "~{batch_id}.h5ad" \
+        --batch_id ~{batch_id} \
+        --pipeline_version ~{pipeline_version}
+    }
+
+    output {
+        File h5ad_output_file = "~{batch_id}.h5ad"
+    }
+
+    runtime {
+        docker: docker
+        cpu: cpu
+        memory: "~{machine_mem_mb} MiB"
+        disks: "local-disk ~{disk} HDD"
+        disk: disk + " GB" # TES
+        preemptible: 3
+        maxRetries: 1
+    }
 }