make output more inline with NCBI guidelines

ctSkennerton · May 8, 2018 · 0f2aeff · 0f2aeff
1 parent 35d5f72
commit 0f2aeff
Show file tree

Hide file tree

Showing 3 changed files with 9 additions and 9 deletions.
diff --git a/CRISPR.java b/CRISPR.java
@@ -140,7 +140,7 @@ public String toGff(String sequenceName, String parentName) {
 	   for (int m = 0; m < numRepeats(); m++) {
 		   int repeat_position = (repeatAt(m) + 1);
 		   int repeat_end = repeat_position + this.repeatLength() - 1;
-		   str += sequenceName + "\tminced:"+minced.VERSION+"\trepeat_unit\t" + repeat_position + "\t" + repeat_end + "\t1\t.\t.\tParent=" + parentName + ";ID=DR"+(m + 1) + "\n";
+		   str += sequenceName + "\tminced:"+minced.VERSION+"\trepeat_unit\t" + repeat_position + "\t" + repeat_end + "\t1\t.\t.\tParent=" + parentName + ";ID=DR."+parentName+'.'+(m + 1) + "\n";
 	   }
 	   return str;
    }

diff --git a/CRISPRFinder.java b/CRISPRFinder.java
@@ -298,9 +298,9 @@ private boolean findRepeats( DNASequence sequence, int readNum )
                 currCRISPR = (CRISPR)CRISPRVector.elementAt(k);
                 if(outputformat > 0) {
                 	String crispr_id = "CRISPR" + (++totalCrisprCount);
-                	out.print(sequence.getName() + "\tminced:" + minced.VERSION + "\tCRISPR\t");
+                	out.print(sequence.getName() + "\tminced:" + minced.VERSION + "\trepeat_region\t");
                     out.print((currCRISPR.start() + 1) + "\t" + (currCRISPR.end() + 1) + "\t");
-                    out.print(currCRISPR.numRepeats() + "\t.\t.\tID="+ crispr_id);
+                    out.print(currCRISPR.numRepeats() + "\t.\t.\tID="+ crispr_id + ";rpt_family=CRISPR;rpt_unit_seq="+ currCRISPR.repeatStringAt(1));
                     out.print("\n");
                     if(outputformat == 2) {
                     	out.print(currCRISPR.toGff(sequence.getName(), crispr_id));

diff --git a/t/Aquifex_aeolicus_VF5.expected b/t/Aquifex_aeolicus_VF5.expected
@@ -1,7 +1,7 @@
 ##gff-version 3
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	156460	156767	5	.	.	ID=CRISPR1
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	244561	244791	4	.	.	ID=CRISPR2
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	279264	279555	5	.	.	ID=CRISPR3
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	1226626	1226861	4	.	.	ID=CRISPR4
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	1379598	1379894	5	.	.	ID=CRISPR5
-gi|15282445|ref|NC_000918.1|	minced:0.2.2	CRISPR	1418900	1419060	3	.	.	ID=CRISPR6
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	156460	156767	5	.	.	ID=CRISPR1;rpt_family=CRISPR;rpt_unit_seq=GTTCCTAATGTACCGTGTGGAGTTGAAACC
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	244561	244791	4	.	.	ID=CRISPR2;rpt_family=CRISPR;rpt_unit_seq=GTTTCAACTCCACACGGTACATTAGGAAC
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	279264	279555	5	.	.	ID=CRISPR3;rpt_family=CRISPR;rpt_unit_seq=GTTTTAACTCCACACGGTACATTAGAAAC
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	1226626	1226861	4	.	.	ID=CRISPR4;rpt_family=CRISPR;rpt_unit_seq=CGTTTCTAATGTACCGTAGAGGAGTTGAAAC
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	1379598	1379894	5	.	.	ID=CRISPR5;rpt_family=CRISPR;rpt_unit_seq=GTTTCAACTCCACTACGGTACATTAGGAAC
+gi|15282445|ref|NC_000918.1|	minced:0.2.2	repeat_region	1418900	1419060	3	.	.	ID=CRISPR6;rpt_family=CRISPR;rpt_unit_seq=GTTCCTAATGTACCGTGTGGAGTTGAAAC